Special Offers
100% Performance Guaranteed
Key Specifications Table
| Species Reactivity | Key Applications |
|---|---|
| H, Ch | ChIP, WB, Cell Function Assay, DB |
| Description | |
|---|---|
| Catalogue Number | 17-10032 |
| Brand Family | Upstate |
| Trade Name |
|
| Description | ChIPAb+ Trimethyl-Histone H3 (Lys36) - ChIP Validated Antibody and Primer Set, rabbit monoclonal |
| Overview | All ChIPAb+ antibodies are individually validated for chromatin precipitation, every lot, every time. Each ChIPAb+ antibody set includes control primers (tested every lot by qPCR) to biologically validate your IP results in a locus-specific context. The qPCR protocol and primer sequences are provided, allowing researchers to validate ChIP protocols when using our antibody in their chromatin context. Each set also includes a negative control antibody to ensure specificity of the ChIP reaction. The ChIPAb+ Trimethyl-Histone H3 (Lys36) set includes the Trimethyl-Histone H3 (Lys36) antibody, a negative control antibody (normal rabbit IgG), and qPCR primers which amplify a 147 bp region of human BDNF intron. The Trimethyl-Histone H3 (Lys36) and negative control antibodies are supplied in a scalable "per ChIP" reaction size and can be used to functionally validate the precipitation of Trimethyl-Histone H3 (Lys36)-associated chromatin. |
| Alternate Names |
|
| Background Information | Histones are highly conserved proteins that serve as the structural scaffold for the organization of nuclear DNA into chromatin. The four core histones, H2A, H2B, H3, and H4, assemble into an octamer (2 molecules of each). Subsequently, 146 base pairs of DNA are wrapped around the octamer, forming a nucleosome, the basic subunit of chromatin. Histones are modified post-translationally by the actions of enzymes in both the nucleus and cytoplasm. These modifications regulate DNA transcription, repair, recombination, and replication. The most commonly studied modifications are acetylation, phosphorylation, methylation, and ubiquitination. These modifications can alter local chromatin architecture, or recruit trans-acting factors that recognize specific histone modifications (the "histone code" hypothesis). The modifications occur predominantly on the N-terminal and C-terminal tails that extend beyond the nucleosome core particle. Methylation of histone H3 on Lys36 (H3K36me2/3) is tightly associated with actively transcribed genes, and this modification is found primarily within the coding region, suggesting H3K36 methylation is necessary for efficient RNA polymerase II elongation and processivity. |
| Product Information | |
|---|---|
| Format | Purified |
| Control |
|
| Presentation | Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50 μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Store at -20°C. Normal Rabbit IgG. One vial containing 125 µg Rabbit IgG in 125 µL of storage buffer containing 0.05% sodium azide. Store at -20°C. ChIP Primers, BDNF Intron. One vial containing 75 μL of 5 μM of each primer specific for human BDNF intron. Store at -20°C. FOR: ACCCCAACCTCTAACAGCATTA REV: TGTCTCTCAGCAGTCTTGCATT |
| Quality Level | MQ100 |
| Applications | |
|---|---|
| Application | This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody & Primer Set conveniently includes the antibody & the specific control PCR primers. |
| Key Applications |
|
| Application Notes | Chromatin Immunoprecipitation: Sonicated chromatin prepared from HeLa cells (1 X 106 cell equivalents per IP) were subjected to chromatin immunoprecipitation using 2 µg of either Normal rabbit IgG or 2 µL Anti-trimethyl-Histone H3 (Lys36) and the Magna ChIP™ A Kit (Cat. # 17-610). Successful immunoprecipitation of trimethyl-Histone H3 (Lys36) associated DNA fragments was verified by qPCR using ChIP Primers, BDNF Intron as a positive locus, and GAPDH promoter primers as a negative locus (Please see figures). Data is presented as percent input of each IP sample relative to input chromatin for each amplicon and ChIP sample as indicated. Please refer to the EZ-Magna ChIP™ A (Cat. # 17-408) or EZ-ChIP™ (Cat. # 17-371) protocol for experimental details. Western Blot Analysis and Peptide Inhibition: Representative lot data. Recombinant Histone H3 (Catalog # 14-411, lane 1) and chicken Core Histones (Catalog # 13-107, lane 2) were resolved by electrophoresis, transferred to nitrocellulose and probed with antitrimethyl-Histone H3 (Lys36) (1:1000 dilution) or anti-trimethyl-Histone H3 (Lys36) pre-adsorbed with 1mM histone H3 peptides containing the following modifications: Lane 3: monomethyl-lysine 36 Lane 4: dimethyl-lysine 36 Lane 5: trimethyl-lysine 36 Lane 6: unmodified Proteins were visualized using a goat anti-rabbit secondary antibody conjugated to HRP and a chemiluminescence detection system. (Please see figures). Peptide Dot Blot Analysis: Representative lot data. A dilution series of Histone H3 peptides containing the following modifications was made: Column 1: unmodified Column 2: monomethyl-lysine 36 Column 3: dimethyl-lysine 36 Column 4: trimethyl-lysine 36 2 μL of each dilution was spotted onto a PVDF membrane and probed with antitrimethyl-Histone H3 (Lys36), (1:1000 dilution). Peptides were visualized using a goat anti-rabbit secondary conjugated to HRP and a chemiluminescence detection system (Please see figures). |
| Biological Information | |
|---|---|
| Immunogen | KLH-conjugated, synthetic peptide containing the sequence ....GVme3KKP…, in which me3K corresponds to human trimethyl-histone H3 (Lys36). |
| Epitope | Trimethylated Lys36 |
| Host | Rabbit |
| Specificity | Recognizes Trimethyl-Histone H3 (Lys36), Mr ~17 kDa. |
| Isotype | IgG |
| Species Reactivity |
|
| Species Reactivity Note | Human, Chicken. Wide reactivity with other species is expected. |
| Antibody Type | Monoclonal Antibody |
| Entrez Gene Number |
|
| Entrez Gene Summary | Histones are basic nuclear proteins that are responsiblefor the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1,with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a member of the histone H3 family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is located separately from the other H3 genes that are in the histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq] |
| Gene Symbol |
|
| Purification Method | Protein A Purfied |
| UniProt Number |
|
| UniProt Summary | FUNCTION: Core component of nucleosome. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling. SUBUNIT STRUCTURE: The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. The octamer wraps approximately 147 bp of DNA. SUBCELLULAR LOCATION: Nucleus. TISSUE SPECIFICITY: Expressed in testicular cells. Developmental stage Expressed during S phase, then expression strongly decreases as cell division slows down during the process of differentiation. PTM: Acetylation is generally linked to gene activation. Acetylation on Lys-10 impairs methylation at Arg-9. Acetylation on Lys-19 and Lys-24 favors methylation at Arg-18 By similarity. Citrullination at Arg-9 and/or Arg-18 by PADI4 impairs methylation and represses transcription By similarity. Asymmetric dimethylation at Arg-18 by CARM1 is linked to gene activation. Symmetric dimethylation at Arg-9 by PRMT5 is linked to gene repression By similarity. Methylation at Lys-5, Lys-37 and Lys-80 are linked to gene activation. Methylation at Lys-5 facilitates subsequent acetylation of H3 and H4. Methylation at Lys-80 is associated with DNA double-strand break (DSB) responses and is a specific target for TP53BP1. Methylation at Lys-10 and Lys-28 are linked to gene repression. Methylation at Lys-10 is a specific target for HP1 proteins (CBX1, CBX3 and CBX5) and prevents subsequent phosphorylation at Ser-11 and acetylation of H3 and H4. Methylation at Lys-5 and Lys-80 require preliminary monoubiquitination of H2B at Lys-120. Methylation at Lys-10 and Lys-28 are enriched in inactive X chromosome chromatin By similarity. Phosphorylated at Thr-4 by GSG2/haspin during prophase and dephosphorylated during anaphase. At centromeres, specifically phosphorylated at Thr-12 from prophase to early anaphase. Phosphorylated at Ser-11 during the whole mitosis. Phosphorylation at Ser-11, which is linked to gene activation, prevents methylation at Lys-10 but facilitates acetylation of H3 and H4. Phosphorylated at Ser-29 by MLTK isoform 1, RPS6KA5 or AURKB during mitosis or upon ultraviolet B irradiation By similarity. Phosphorylation at Ser-11 is crucial for chromosome condensation and cell-cycle progression during mitosis and meiosis. In addition phosphorylation at Ser-11 is important during interphase because it enables the transcription of genes following external stimulation, like stress or growth factors. Phosphorylation at Ser-11 is also an essential regulatory mechanism for neoplastic cell transformation. Phosphorylation at Ser-11 by AURKB/Aurora-B mediates the dissociation of HP1 proteins (CBX1, CBX3 and CBX5) from heterochromatin. Ubiquitinated By similarity. SIMILARITY:Belongs to the histone H3 family. |
| Molecular Weight | ~17 kDa |
| Product Usage Statements | |
|---|---|
| Quality Assurance | Chromatin Immunoprecipitation: Sonicated chromatin prepared from HeLa cells (1 X 106 cell equivalents per IP) were subjected to chromatin immuno-precipitation using 2 µg of either Normal Rabbit IgG or 2 µL Anti-trimethyl-Histone H3 (Lys36) and the Magna ChIP™ A Kit (Cat. # 17-610). Successful immunoprecipitation of trimethyl-Histone H3 (Lys36) associated DNA fragments was verified by qPCR using ChIP Primers, BDNF Intron (Please see figures). Please refer to the EZ-Magna ChIP™ A (Cat. # 17-408) or EZ-ChIP™ (Cat. # 17-371) protocol for experimental details. |
| Usage Statement |
|
| Storage and Shipping Information | |
|---|---|
| Storage Conditions | Stable for 1 year at -20°C from date of receipt. Handling Recommendations: Upon first thaw, and prior to removing the cap, centrifuge the vial and gently mix the solution. Aliquot into microcentrifuge tubes and store at -20°C. Avoid repeated freeze/thaw cycles, which may damage IgG and affect product performance. Note: Variability in freezer temperatures below -20°C may cause glycerol containing solutions to become frozen during storage. |
| Packaging Information | |
|---|---|
| Material Size | 25 assays |
| Material Package | 25 assays per set. Recommended use: ~2 μL of antibody per chromatin immunoprecipitation (dependent upon biological context). |